Skip to main content

Table 1 Sequences of primers for RT-qPCR

From: Descending controls modulate inflammatory joint pain and regulate CXC chemokine and iNOS expression in the dorsal horn

Gene name Primer Sequence
Cyclin B2 Ccnb2F CTAAGAGCCATGTGACTGTC
  Ccnb2R CAGAACTGTAGGTTTCGG
Chemokine (C-X-C motif) ligand 10 Cxcl10F ATACTCACAGGAACCTAGACAT
  Cxcl10R CCATCCAACACATCTTGTAATATG
Ribosomal protein L32 Rpl32F GTTCATCAGGCACCAGTC
  Rpl32R TGACATCGTGGACCAGAA
Chemokine (C-X-C motif) ligand 9 Cxcl9F GATGAAGCCCTTTCATACTGC
  Cxcl9R GTGGTTGTGAGTTTTGCTCCAATC
Chemokine (C-X-C motif) receptor 3 Cxcr3F AGCCCTCACCTGCATAGTTG
  Cxcr3R GCCACTAGCTGCAGTACACG
Nitric oxide synthase 2 Nos2F GATATCTTCGGTGCGGTCTT
  Nos2R GGCCAGATGCTGTAACTCTT