Skip to main content

Table 1 Sequences of primers used for RT-PCR

From: Variability in C-type lectin receptors regulates neuropathic pain-like behavior after peripheral nerve injury

Target name Forward sequence Reverse sequence
Gapdh TCA ACT ACA TGG TCT ACA TGT TCC AG TCC CAT TCT CAG CCT TGA CTG
Hprt CTC ATG GAC TGA TTA TGG ACA GCA GGT CAG CAA AGA ACT TAT
SP TGG CGG TCT TTT TTC TCG TT GCA TTG CCT CCT TGA TTT GG
CGRP GTG TCA CTG CCC AGA AGA GAT C CAA AGT TGT CCT TCA CCA CAC C
IL-1β GAAAGACGGCACACCCACC AAACCGCTTTTCCATCTTCTTCT
Dcir1 CCATAGCAAGGAAGAACAGGACTT TGAATCCCAGAGCCCTATAAAATAA
Dcir2 CCATCATCCAAGTAAGCCAGGTTC GAGTCAGTTGAAGTAAAGTAGCAGTAG
Dcir3 TGCCACAAGTTCTCCAAG TCCAATTCAGTATAGTTCAGTTCC
Dcir4 CATTCGTCCGTGGAAGACAAA TGCAGAGTCCCTGGAAGTGAA
Dcar1 TGCTCATCTGTTGGTGATCCA TGTAAAATAACCCCAACGAGTGTCTA
Mcl CACAAGGCTAACATGCATCCTAGA GCAAAGTAACAGTTAGACTGGAATGCT
Mincle TTTCACAGAGTCCCTGAGCTTCT TCCCTCATGGTGGCACAGT
TNF-α GACCCTCACACTCAGATCCAGATCATCTTCT ACGCTGGCTCAGCCACTC
Ccr-2 AGAAGTATCCAAGAGCTTGATGAGG ATAGTGAGCCCAGAATGGGAG
Ccl-2 AACTCTCACTGAAGCCAGAT GGTGACAAATACTACAGCTTC
Cx3cr1 CTGCTCAGGACCTCACCAT CAGACCGAACGTGAAGACAA
Cathepsin S TGT TCT CGT GGT TGG CTA T AAC GGT TTA GAT TTC TGG GT
IL-6 AGAAAAGAGTTGTGCAATGG ACAAACTCCAGGTAGAAACG