Skip to main content

Table 2 Detailed information on the selection of primers for real-time RT-PCR experiments

From: Transforming growth factor-β1 impairs neuropathic pain through pleiotropic effects

Gene Description GenBank Region Size (pb) Primers sequence: 5' → 3' (S/AS)
IL-1β Rattus norvegicus interleukin 1 beta NM_031512 456–639 184 CTCGTGCTGTCTGACCCATGT/TGGGTGTGCCGTCTTTCATCA
TNF-α Rattus norvegicus tumor necrosis factor NM_012675 426–668 243 CGTCGTAGCAAACCACCAAGC/ATGGCGGAGAGGAGGCTGACT
IL-6 Rattus norvegicus interleukin 6 NM_012589 474–735 262 ACAAAGCCAGAGTCATTCAGAGCAA/AATGTCCACAAACTGATATGCTTAGGC
Atp5o Rattus norvegicus ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit NM_138883 223–453 231 GGTGTCCCTTGCTGTTCTGAA/TCTAAAGGAAACGCTGTGGTCA
Hprt1 Rattus norvegicus hypoxanthine guanine phosphoribosyl transferase 1 NM_012583 38–266 229 CAGTCCCAGCGTCGTGATTAGT/ATCCAGCAGGTCAGCAAAGAACT
G6pdx Rattus norvegicus glucose-6-phosphate dehydrogenase X-linked NM_017006 1429–1664 236 GTATCTTCACACCATTGCTGCA/TTAGATGGTGAGAAGGGCAGAT