Table 2 Detailed information on the selection of primers for real-time RT-PCR experiments
From: Transforming growth factor-β1 impairs neuropathic pain through pleiotropic effects
Gene | Description | GenBank | Region | Size (pb) | Primers sequence: 5' → 3' (S/AS) |
|---|---|---|---|---|---|
IL-1β | Rattus norvegicus interleukin 1 beta | NM_031512 | 456–639 | 184 | CTCGTGCTGTCTGACCCATGT/TGGGTGTGCCGTCTTTCATCA |
TNF-α | Rattus norvegicus tumor necrosis factor | NM_012675 | 426–668 | 243 | CGTCGTAGCAAACCACCAAGC/ATGGCGGAGAGGAGGCTGACT |
IL-6 | Rattus norvegicus interleukin 6 | NM_012589 | 474–735 | 262 | ACAAAGCCAGAGTCATTCAGAGCAA/AATGTCCACAAACTGATATGCTTAGGC |
Atp5o | Rattus norvegicus ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit | NM_138883 | 223–453 | 231 | GGTGTCCCTTGCTGTTCTGAA/TCTAAAGGAAACGCTGTGGTCA |
Hprt1 | Rattus norvegicus hypoxanthine guanine phosphoribosyl transferase 1 | NM_012583 | 38–266 | 229 | CAGTCCCAGCGTCGTGATTAGT/ATCCAGCAGGTCAGCAAAGAACT |
G6pdx | Rattus norvegicus glucose-6-phosphate dehydrogenase X-linked | NM_017006 | 1429–1664 | 236 | GTATCTTCACACCATTGCTGCA/TTAGATGGTGAGAAGGGCAGAT |