Skip to main content

Table 1 SiRNA oligo

From: Down-regulation of Toll-like receptor 4 gene expression by short interfering RNA attenuates bone cancer pain in a rat model

Gene Primer forward Primer reverse
MC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
312 CCUUGGUACUGACAGGAAATT UUUCCUGUCAGUACCAAGGTT
439 GCUUAUAUCCUUAAAGAAATT UUUCUUUAAGGAUAUAAGCTG
1495 GGAUCUUUCUAAAUGCCAATT UUGGCAUUUAGAAAGAUCCAG
2062 CGAGCUGGUAAAGAAUUUATT UAAAUUCUUUACCAGCUCGTT
  1. Sequences of short interfering RNA (siRNA) constructs used in this study. In addition to a mismatch control siRNA construct, foure different siRNA duplexes were designed that targeted the coding region of the rat TLR4 mRNA (NM_019178).