Skip to main content

Table 1 The sequences of the primers for RT-PCR

From: Acute morphine induces matrix metalloproteinase-9 up-regulation in primary sensory neurons to mask opioid-induced analgesia in mice

Target gene Forward primers Reverse primers Genbank No.
MMP-9 GATCCCCAGAGCGTCATTC CCACCTTGTTCACCTCATTTTG NM013599
TIMP-1 CTCAAAGACCTATAGTGCTGGC CAAAGTGACGGCTCTGGTAG NM011593
GAPDH TCCATGACAACTTTGGCATTG CAGTCTTCTGGGTGGCAGTGA XM001473623