Skip to main content

Table 1 RT-PCR primer pairs and PCR product sizes

From: Positive allosteric modulation of TRPV1 as a novel analgesic mechanism

Gene Primer pairs Product (bp)
NPY CCGCCCGCCATGATGCTAGG 150
  GGCCATGTCCTCTGCTGGCG  
GAL CCTCGTGCGCTTCCCTACGC 148
  GCCCCTGGCCATCTTGAGCA  
ATF3 GGACGACCGACCAACCCGC 122
  CATTTTGCTCCAGTCTTCGCTCGGG  
VIP GGACCAGGGGCAGACTCCGT 121
  TCCATCTCGGTGCCTCCTTGGG  
MCP-1 GAGGCCAGCCCAGAAACCAGC 153
  TGGGGCATTAACTGCATCTGGC  
GAPDH GGGGCTCTCTGCTCCTCCCTG 108
  ACGGCCAAATCCGTTCACACC