Skip to main content

Table 1 Primer sequences employed for RT-PCR analysis

From: Translocation of neuronal nitric oxide synthase to the plasma membrane by ATP is mediated by P2X and P2Y receptors

Gene Primer sequences (5' to 3') Product length (bp)
P2X1 (forward) TGATCTGGACTGGCACGTTC 441
P2X1 (reverse) GGTCCTCATGTTCTCCTGCA  
P2X3 (forward) TGGCG TTCTG GGTAT TAAGA TCGG 743
P2X3 (reverse) CAGTG GCCTG GTCAC TGGCG A  
P2X4 (forward) GAGGC ATCAT GGGTA TCCAG ATCAA G 447
P2X4 (reverse) GAGCG GGGTG GAAAT GTAAC TTTAG  
P2X6 (forward) CGATT CACTC TCCAG TCCG 317
P2X6 (reverse) GGTCC TCCAG TAGAA ACCG  
P2Y2 (forward) CGCTT CAACG AGGAC TTCA 589
P2Y2 (reverse) CCATG AGCAC GTAAC AGAC  
P2Y4 (forward) GTTGC CTATG AGCTA TGCAG 518
P2Y4 (reverse) ACCAT GACTG CCGAA CTGAA  
P2Y6 (forward) GGAGA CCTTG CCTGC CGCCT GGTA 410
P2Y6 (reverse) TACCA CGACA GCCAT ACGGG CCGC  
β-actin (forward) TTCTA CAATG AGCTG CGTGT GGC 456
β-actin (reverse) CTC(A/G)T AGCTC TTCTC CAGGG AGGA 982
G3PDH (forward) TGAAGGTCGGTGTGAACGGATTTGGC  
G3PDH (reverse) CATGTAGGCCATGAGGTCCACCAC