Skip to main content

Table 1 Primers sequences for quantitative Real-Time PCR.

From: Differential regulation of immune responses and macrophage/neuron interactions in the dorsal root ganglion in young and adult rats following nerve injury

Serine (or cysteine) inhibitor, clade A, member 3N Sens CAGGCAATGCCCTGTTTATT
  Antisens CACGAGACTGCTGGAAATCA
Serine (or cysteine) inhibitor, clade B, member 2 Sens CACCACGCTTGGGAGATTAT
  Antisens TTCATTGGCACATTCAAGGA
Interleukin-6 Sens CTTCCAGCCAGTTGCCTTCTTG
  Antisens TGGTCTGTTGTGGGTGGTATCC
Mitogen-activated protein kinase kinase 6 Sens GTTGACTTTACCTCACAGTGCTTGAAG
  Antisens TCCCCGAGTATCAGTTTTACGAAAGAC
Chemokine (C-C motif) ligand 2 Sens ATGCAGTTAATGCCCCACTC
  Antisens TTCCTTATTGGGGTCAGCAC
Inositol 1,4,5-trisphosphate 3-kinase C Sens TGATGGCTCCCTCATAGGAC
  Antisens TCACCAAGTCTCTGGGCTCT
Matrix metallopeptidase 16 Sens GGAATTGGAGGCGATACTCA
  Antisens CCAGCTCATGGACTGCTACA
Monoamino oxidase A Sens AGCAAGACACGCTCAGGAAT
  Antisens CCACAGGGCAGATACCTCAT
Glyceraldehyde-3-phosphate dehydrogenase Sens ACTCTACCCACGGCAAGTTC
  Antisens GGTGGTGAAGACGCCAGTAG
Caspase 3 Sens CCCTCTCATTTAAATCAAATCCG
  Antisens GTTCCTAATTAAATTTCATTTCAACTACC
Toll like receptor 4 Sens TCTCTTTAGACCTGTCTTTAAACC
  Antisens AAGGCACATTTTCAGTACATTTG
Matrix metallopeptidase 3 Sens TTGATGAGAAGAAACAATCCATG
  Antisens CGCTGAAGAAGTAAAGAAACC
Complement component3 Sens GAGCAAGCTGTGCCACAATG
  Antisens GGTCTTGTACACGTAGTCCACTC
cAMP responsive element modulator Sens ATGAAACTGATGAGGAGACTGACC
  Antisens GCTCGGATCTGGTAAGTTGGC
Colony stimulating factor 1 (macrophage) Sens ATCCCGTTTGCTACCTAAAG
  Antisens AGCTGTTCAGTTTCATAGAGAG
Chloride intracellular channel 1 Sens TCCACGTTGCTACATAATGG
  Antisens CCCTTGTCCTCTAATCTTTCC
Purinergic receptor P2Y, G-protein coupled, 14 Sens ACATACAGTGCATGGAACTC
  Antisens CAGAAAATGCTCACGAAGAC